Review




Structured Review

BioResource International Inc expression plasmid from aska clone library
Expression Plasmid From Aska Clone Library, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clones+of+aska+library/pm39905026-674-15-25?v=BioResource+International+Inc
Average 90 stars, based on 1 article reviews
expression plasmid from aska clone library - by Bioz Stars, 2026-07
90/100 stars

Images



Similar Products

90
BioResource International Inc expression plasmid from aska clone library
Expression Plasmid From Aska Clone Library, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clones+of+aska+library/pm39905026-674-15-25?v=BioResource+International+Inc
Average 90 stars, based on 1 article reviews
expression plasmid from aska clone library - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
BioResource International Inc an expression plasmid from the aska clone library
An Expression Plasmid From The Aska Clone Library, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clones+of+aska+library/pmc11794783-204-15-27?v=BioResource+International+Inc
Average 90 stars, based on 1 article reviews
an expression plasmid from the aska clone library - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
BioResource International Inc complete set of orf clones of e. coli (aska plasmid library)
Complete Set Of Orf Clones Of E. Coli (Aska Plasmid Library), supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clones+of+aska+library/pm38063383-45-22-37?v=BioResource+International+Inc
Average 90 stars, based on 1 article reviews
complete set of orf clones of e. coli (aska plasmid library) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
BioResource International Inc aska library clones
Aska Library Clones, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clones+of+aska+library/pm34672004-327-41-29?v=BioResource+International+Inc
Average 90 stars, based on 1 article reviews
aska library clones - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier


Image Search Results


Four scenes are shown: (1) A view of the complete 70S complex, as in <xref ref-type=Figure 1A and B . The stalled ribosome with a truncated mRNA and a vacant A site, identified in our cryo-EM sample ( Figure 1—figure supplement 1 ) is followed by Structure I and Structure II. (2) The opening of RF2, from Structure I to II, coupled with the movement of the L11 stalk. The transition between Structure I and Structure II was generated using the UCSF Chimera ‘Morph Conformations’ tool. (3) A close-up view of the decoding center, showing the rearrangements of ribosomal nucleotides, ArfA and RF2, coupled with the opening of domain 3 of RF2. (4) A proposed mechanism of ribosome rescue by ArfA and RF2, schematically shown in Figure 5 . The animation is also available at http://labs.umassmed.edu/korostelevlab/movarfa.gif DOI: http://dx.doi.org/10.7554/eLife.23687.016 " width="100%" height="100%">

Journal: eLife

Article Title: Mechanism of ribosome rescue by ArfA and RF2

doi: 10.7554/eLife.23687

Figure Lengend Snippet: Four scenes are shown: (1) A view of the complete 70S complex, as in Figure 1A and B . The stalled ribosome with a truncated mRNA and a vacant A site, identified in our cryo-EM sample ( Figure 1—figure supplement 1 ) is followed by Structure I and Structure II. (2) The opening of RF2, from Structure I to II, coupled with the movement of the L11 stalk. The transition between Structure I and Structure II was generated using the UCSF Chimera ‘Morph Conformations’ tool. (3) A close-up view of the decoding center, showing the rearrangements of ribosomal nucleotides, ArfA and RF2, coupled with the opening of domain 3 of RF2. (4) A proposed mechanism of ribosome rescue by ArfA and RF2, schematically shown in Figure 5 . The animation is also available at http://labs.umassmed.edu/korostelevlab/movarfa.gif DOI: http://dx.doi.org/10.7554/eLife.23687.016

Article Snippet: The gene encoding E. coli ArfA (ASKA Clone(-) library, National BioResource Project, NIG, Japan) was subcloned into pET24b+ (Novagen) kanamycin resistance vector using the primer set CCCG CATATG CATCACCATCACCATCACATGAGTCGATATCAGCATACTAAAGGGC/CCCG GGATCC GTGATTTACTTTCTTGCCAC containing the NdeI/BamHI restriction sites (underlined) and transformed into an E. coli BLR/DE3 strain.

Techniques:

( A ) The P and A sites of Structure I. ArfA is shown in red; RF2 in blue; mRNA in green; P-tRNA in orange; 30S subunit in yellow; and 50S subunit in light blue. ( B ) Superposition of RF2 from Structure I (blue) with the crystal structure of free (ribosome-unbound) E. coli RF2 (PDB 1GQE) (pink). Relative positions of the codon-recognition superdomain (domains 2 and 4) and catalytic domain 3 are nearly identical. The positions of domain 1 differ; this domain in both Structures I and II interacts with the L11 stalk at the 50S subunit shown in panels ( A ), ( C ) and ( F ). ( C ) The P and A sites of Structure II. The color coding is as in panel ( A ). ( D ) Superposition of extended RF2 in Structure II (blue) with Thermus thermophilus RF2 in the canonical termination complex formed on the UAA stop codon (PDB 4V67) (pink). The superposition was performed by structural alignment of 16S ribosomal RNAs. RF2 adopts similar conformations but domains 2 and 3 are positioned slightly differently with respect to the 30S subunit in the rescue complex II and in the termination complex (see also ). ( E ) Superposition of RF2 in Structures I (blue) and II (cyan), achieved by structural alignment of the 16S ribosomal RNAs. Conformations of RF2 and positions relative to the 30S subunit differ between Structures I and II, as RF2 in Structure II binds deeper in the A site; differences in positions of RF2 regions are labeled with arrows. ( F ) Different positions of the L11 stalk, which interacts with domain 1 of RF2, in Structures I (light blue) and II (cyan), suggesting movement of the stalk together with domain 1 ( E ) upon RF2 activation. The view is similar to that shown in panels A , C and E . In panels ( B ), ( D ) and ( E ), the Arabic numerals label the domains of RF2. DOI: http://dx.doi.org/10.7554/eLife.23687.013

Journal: eLife

Article Title: Mechanism of ribosome rescue by ArfA and RF2

doi: 10.7554/eLife.23687

Figure Lengend Snippet: ( A ) The P and A sites of Structure I. ArfA is shown in red; RF2 in blue; mRNA in green; P-tRNA in orange; 30S subunit in yellow; and 50S subunit in light blue. ( B ) Superposition of RF2 from Structure I (blue) with the crystal structure of free (ribosome-unbound) E. coli RF2 (PDB 1GQE) (pink). Relative positions of the codon-recognition superdomain (domains 2 and 4) and catalytic domain 3 are nearly identical. The positions of domain 1 differ; this domain in both Structures I and II interacts with the L11 stalk at the 50S subunit shown in panels ( A ), ( C ) and ( F ). ( C ) The P and A sites of Structure II. The color coding is as in panel ( A ). ( D ) Superposition of extended RF2 in Structure II (blue) with Thermus thermophilus RF2 in the canonical termination complex formed on the UAA stop codon (PDB 4V67) (pink). The superposition was performed by structural alignment of 16S ribosomal RNAs. RF2 adopts similar conformations but domains 2 and 3 are positioned slightly differently with respect to the 30S subunit in the rescue complex II and in the termination complex (see also ). ( E ) Superposition of RF2 in Structures I (blue) and II (cyan), achieved by structural alignment of the 16S ribosomal RNAs. Conformations of RF2 and positions relative to the 30S subunit differ between Structures I and II, as RF2 in Structure II binds deeper in the A site; differences in positions of RF2 regions are labeled with arrows. ( F ) Different positions of the L11 stalk, which interacts with domain 1 of RF2, in Structures I (light blue) and II (cyan), suggesting movement of the stalk together with domain 1 ( E ) upon RF2 activation. The view is similar to that shown in panels A , C and E . In panels ( B ), ( D ) and ( E ), the Arabic numerals label the domains of RF2. DOI: http://dx.doi.org/10.7554/eLife.23687.013

Article Snippet: The gene encoding E. coli ArfA (ASKA Clone(-) library, National BioResource Project, NIG, Japan) was subcloned into pET24b+ (Novagen) kanamycin resistance vector using the primer set CCCG CATATG CATCACCATCACCATCACATGAGTCGATATCAGCATACTAAAGGGC/CCCG GGATCC GTGATTTACTTTCTTGCCAC containing the NdeI/BamHI restriction sites (underlined) and transformed into an E. coli BLR/DE3 strain.

Techniques: Labeling, Activation Assay